<< All Back-issues
<< This Issue's Table of Contents
ILAR Journal V42(2) 2001
Animal Models of Hepatitis
The Chimpanzee Model of Hepatitis C Virus Infections
Robert E. Lanford, Catherine Bigger, Suzanne Bassett, and Gary Kimpel
| Robert E. Lanford, Ph.D., and Catherine Bigger, Ph.D., are Staff Scientist and Scientist, respectively, in the Department of Virology and Immunology, Southwest Regional Primate Research Center, Southwest Foundation for Biomedical Research, San Antonio, Texas. Suzanne Bassett, Ph.D., and Gary Klimpel, Ph.D., are Postdoctoral Fellow and Professor, respectively, in the Department of Microbiology and Immunology, University of Texas Medical Branch, Galveston, Texas. |
Abstract
The chimpanzee (Pan troglodytes) is the only experimental animal susceptible to infection with hepatitis C virus (HCV). The chimpanzee model of HCV infection was instrumental in the initial studies on non-A, non-B hepatitis, including observations on the clinical course of infection, determination of the physical properties of the virus, and eventual cloning of the HCV nucleic acid. This review focuses on more recent aspects of the use of the chimpanzee in HCV research. The chimpanzee model has been critical for the analysis of early events in HCV infection because it represents a population for which samples are available from the time of exposure and all exposed animals are examined. For this reason, the chimpanzee represents a truly nonselected population. In contrast, human cohorts are often selected for disease status or antibody reactivity and typically include individuals that have been infected for decades. The chimpanzee model is essential to an improved understanding of the factors involved in viral clearance, analysis of the immune response to infection, and the development of vaccines. The development of infectious cDNA clones of HCV was dependent on the use of chimpanzees, and they will continue to be needed in the use of reverse genetics to evaluate critical sequences for viral replication. In addition, chimpanzees have been used in conjunction with DNA microarray technology to probe the entire spectrum of changes in liver gene expression during the course of HCV infection. The chimpanzee will continue to provide a critical aspect to the understanding of HCV disease and the development of therapeutic modalities.
Key Words: DNA microarray; hepatitis C virus; HCV; Pan troglodytes; T cell
Introduction to Hepatitis C Virus
Hepatitis C virus (HCV1) infections are a major worldwide health problem. Approximately 3% of the world's population is chronically infected with HCV (Anonymous1997), and the recent National Health and Nutrition Examination and Survey (NHANES III) estimates that 3 to 4% of the US adult 30- to 50-yr-old population is persistently infected (Alter et al. 1999). HCV has a great propensity for inducing lifelong persistent infections that can progress to significant liver disease including cirrhosis and hepatocellular carcinoma (Alter 1995; NIH 1997). Currently, chronic HCV infection is the leading cause for liver transplantation in the United States (Hoofnagle 1997). Treatment involves 6 to 12 mo of combination therapy with interferon-a and ribavirin (Ahmed and Keeffe 1999). Although surprisingly efficacious for the treatment of a chronic infection with two nonspecific antivirals, the majority of individuals infected with genotype 1 will not experience long-term viral clearance.
HCV is a member of the Hepacivirus genus of the Flaviviridae family. Individual isolates have considerable sequence variation, and six genotypes are recognized at the time of this writing (Robertson et al. 1998). The genome is single-stranded, positive-sense RNA of approximately 9600 nucleotides (nt) and encodes a polyprotein with a single open reading frame of 3008 to 3033 amino acids (Houghton et al. 1994). The structural proteins precede the nonstructural proteins in the polyprotein and consist of a capsid protein, two envelope proteins (E1 and E2), and potentially p7. The nonstructural (NS1) proteins are NS2, NS3, NS4A, NS4B, NS5A, and NS5B. Although the precise functions of some of the HCV proteins are unknown, most have been characterized after expression in heterologous systems: NS2 is a metalloprotease; NS3 is a serine protease and RNA helicase; NS4A is a cofactor for the serine protease, and NS5B is the RNA-dependent RNA polymerase (Figure 1; Reed and Rice 1998). The 5' untranslated region (UTR1) contains an internal ribosome entry site for translation of the polyprotein (Honda et al. 1999). The 3' UTR contains a terminal 98 nt conserved sequence presumably involved in RNA replication that is preceded by a short region of significant sequence variation and a polyU/polypyrimidine stretch of variable length (Blight and Rice 1997; Kolykhalov et al. 1996; Tanaka et al. 1995, 1996).
HCV pathogenesis is difficult to study because conventional tissue culture systems are not available and no small animal model exists. At the time of this writing, chimpanzees serve as the only animal model for HCV infection. The understanding of HCV infection has been greatly enhanced by the chimpanzee animal model. Many factors involved in HCV infection have been examined in chimpanzees, such as transmission, genetic drift, clinical outcome of HCV infection, and the role of the immune response (Prince and Brotman 1994; Walker 1997). Similar to humans, both viral clearance and persistent viremia in HCV-infected chimpanzees have been observed. The initial cloning of HCV was made possible through the development of high titered pools of chimpanzee serum as a source of virus for cloning experiments (Choo et al. 1989), and the development of infectious cDNA clones of HCV required the inoculation of chimpanzees to demonstrate infectivity (Beard et al. 1999; Bukh et al. 1998; Hong et al. 1999; Kolykhalov et al. 1997; Lanford et al. 2001). Among the numerous advantages of studying HCV infections in chimpanzees are the opportunity to induce infections with well-characterized HCV inocula, the ability to obtain liver tissue samples during the course of infection, and, most importantly, the availability of specimens from the time of infection for the analysis of events early in infection.
Analysis of Viral Persistence and Clearance in an HCV-exposed Chimpanzee Cohort
Substantial HCV research has been conducted in chimpanzees in various colonies during the past 20 yr, much of which was conducted on non-A, non-B hepatitis (NANBH1) before the isolation of HCV. Most studies were understandably conducted with small numbers of animals and little effort has been made to compile the data from previous studies. As a starting point to determine the clinical course of HCV infections in this valuable animal model, a retrospective examination was conducted of all animals previously exposed to HCV in the chimpanzee colony at the Southwest Regional Primate Research Center/Southwest Foundation for Biomedical Research (SFBR1). The objectives of the study were (1) confirmation of HCV infection in NANBH-inoculated animals to establish a cohort of HCV-infected animals, (2) evaluation of persistence of infection by detection of viral RNA in the serum using reverse transcription/polymerase chain reaction (RT-PCR1), (3) evaluation of anti-HCV antibody response by enzyme-linked immunosorbent and recombinant immunoblot assays, (4) comparison of anti-E1 and anti-E2 responses in chimpanzee and human cohorts, and (5) sequence evaluation of the E2 hypervariable region 1 (HVR11).
SFBR accommodates 249 chimpanzees, 52 of which had been exposed to various NANBH and HCV inocula at the time these studies were initiated. Because some of the animals received uncharacterized inocula, it was first necessary to determine the number of animals with confirmed HCV infections. Prior HCV infections were confirmed in 46 chimpanzees (Figure 2). Initially, current serum samples were examined for the presence of anti-HCV antibody and viral RNA. Anti-HCV antibody and/or HCV RNA were detected in serum samples from 22 chimpanzees; 18 of the animals were PCR+/Ab+ and thus were chronic carriers; four were PCR- Ab+; and 30 animals were PCR-/Ab- and thus had no evidence of previous infection with HCV. Additional analyses demonstrated that the PCR-/Ab+ animals had cleared their infections but had not yet lost antibody reactivity. The PCR-/Ab- animals would be considered normal controls in a human study; however, because clinical records indicated that they had been inoculated with NANBH or HCV in the past, archived serum samples were examined. Using archived serum, previous HCV infection was confirmed in 24 PCR-Ab- chimpanzees. The remaining six animals were excluded from these studies. These chimpanzees may have been inoculated with a noninfectious inoculum, an inoculum containing a non-A, non-B, non-C hepatitis virus, or, more likely, the serum samples available for analysis may not have been optimal for the detection of anti-HCV antibody or HCV RNA. When the two PCR negative groups are considered together, 61% of the animals had cleared viral infection (Bassett et al. 1998). This percentage obviously represents a very high clearance rate compared with what has been reported in humans.
Of the 46 animals with confirmed HCV infections, the chimpanzees had been inoculated an average 10.6 yr earlier. A correlation was observed between viremia and serum alanine transaminase (ALT1) elevations (a marker of liver damage), with 44% of the viremic animals having abnormal ALT elevations compared with none of the PCR-Ab- animals. The antibody response to individual antigens was determined by recombinant immunoblot assay. Viremic chimpanzees had a high prevalence of antibody reactivity to NS3, NS4, and NS5, whereas most animals that had cleared the virus were antibody negative. From the cross-sectional analysis, we could not differentiate between lack of response to these antigens and loss of response after viral clearance.
Persistent infection has been estimated to occur in 85% of infected humans, yet these data suggested that only 30 to 40% of chimpanzees had become persistently infected. The lower percentage of persistent infections in chimpanzees could be explained if chimpanzees experience a different clinical course than humans, or if the full clinical spectrum of HCV infections in humans is not observed because of the way cohorts are selected. This latter point is very important. One of the primary advantages of the chimpanzee is that it represents a truly unselected population. Most of what is known of the clinical parameters of HCV infections in humans is derived from cohorts that were selected for disease status or antibody response to HCV proteins. The cohorts mostly represent individuals that have been infected for some period of time, often decades. Very little information is available with regard to the events that occur in the first few months after infection. In contrast, chimpanzees are monitored from the time of exposure, and all exposed animals are characterized. Thus, the population is unselected.
Because an unexpectedly low percentage of chimpanzees was persistently infected with HCV, a longitudinal analysis of a panel of HCV-infected chimpanzees was performed to examine the kinetics of viral clearance and antibody loss. In general, the infection profiles can be grouped into three categories: persistently infected animals, animals that cleared the infection with a gradual loss of antibody over several years, and animals that rapidly cleared the infection with rapid loss of antibody. An example of a profile with rapid viral clearance is shown in Figure 3.
If extrapolated to the human population, the chimpanzee data would imply that the potential exists for underestimation of HCV infections in humans. Human cohort studies would not detect asymptomatic individuals with rapid viral clearance and rapid loss of antibody. Closely spaced serial bleeds from the time of exposure would be required to detect such infections, and the time of infection is rarely known in humans. Infection in humans is often not detected for decades.
More data from human cohorts are becoming available that at least partially support this conclusion. One of the most significant findings is that HCV-negative humans often have a cellular immune response to HCV antigens (Koziel et al. 1997), especially the family members of infected individuals (Scognamiglio et al. 1999) and health care workers with a history of occupation exposure (Koziel et al. 1997). In addition, a cohort of Irish women exposed to contaminated anti-D immunoglobulin exhibited a 46% viral clearance rate (Barrett et al. 1999). Recent analysis of a cohort of German women exposed to contaminated anti-D immunoglobulin suggested that many of the individuals cleared viral infection and lost antibody reactivity, yet retained cellular immune responses to HCV proteins (Takaki et al. 2000). These data indicate that the high level of viral clearance and loss of antibody reactivity first observed in the chimpanzee model can be extended to human HCV infections. Regardless of whether the rate of clearance is similar in humans and chimpanzees, the high rate of clearance in chimpanzees makes it an ideal animal model for probing the mechanism of viral clearance.
Humoral Immune Response to the Envelope Proteins E1 and E2 and Sequence Divergence in the HVR1
Although the mechanisms for maintaining viral persistence are unknown, immune escape variants are believed to play an essential role. HCV infection persists despite the presence of virus-specific cytotoxic T cells and circulating antibodies to HCV proteins. HCV variants arise frequently due to the high error rate of the viral RNA-dependent RNA polymerase, and HCV virions thus circulate as a quasispecies. Quasispecies are a heterogeneous population of minor variants along with a predominant species. HCV infection may persist due to the presence of a quasispecies, and the continuous selection of variants that escape neutralization or cytotoxic T lymphocyte (CTL1) recognition. HVRs are present within the envelope glycoproteins and may be particularly important in maintaining chronicity (Barrett et al. 1999; Forns et al. 1999; Houghton et al. 1991; Kato et al. 1992; Okamoto et al. 1992; Weiner et al. 1991). The first HVR, HVR1, within E2 has the most significant diversity. Antibodies elicited against the E2 HVR-1 have been proposed to neutralize the virus as well as to promote immune selection and genetic drift of the E2 HVR1 (Farci et al. 1994, 1996; Kato et al. 1993; Ray et al. 1999; Taniguchi et al. 1993; Weiner et al. 1992).
Studies in chimpanzees suggested that neutralizing antibodies may be elicited but are probably specific for only one particular HCV variant (Farci et al. 1994). Antibodies against a specific isolate were not able to neutralize some of the variants present in the complex quasispecies of the inocula. Attempts to prevent HCV infection in chimpanzees with HCV immune globulin also suggested that neutralization was not easily achieved (Krawczynski et al. 1996). However, hyperimmune serum to a given HVR was able to neutralize homologous virus based on challenge of a chimpanzee with virus incubated in vitro with the hyperimmune serum (Farci et al. 1996). In addition, chimpanzees that were immunized with recombinant envelope proteins were protected against challenge with a homologous virus (Choo et al. 1994).
To determine whether the rapid viral clearance profile was related to a vigorous neutralizing antibody response, we examined the antibody response to the envelope proteins (Bassett et al. 1999b). Recombinant E1 and E2 proteins were expressed and purified using the baculovirus/insect cell system, and enzyme-linked immunosorbent assays were developed to measure the antienvelope antibodies. The antibody rates of response to E1 and E2 were first determined using several human serum panels, such that a comparison with the response rate in chimpanzees could be made. Samples from blood donors rejected from the blood bank due to high ALT and anti-HCV antibodies exhibited 41 and 59% reactivity for anti-E1 and anti-E2, respectively. Sera from a large panel of anti-HCV-positive intravenous drug users displayed very high reactivity in the assays for anti-E1 (58%) and anti-E2 (93%). The reason for the higher percentage of reactivity in the drug user panel in comparison with the blood donor panel is not clear. The duration of infection could be greater, or possibly intravenous drug users have higher reactivity due to repeated exposure to HCV. The anti-HCV positive chimpanzees had a low response rate to both E1 (18%) and E2 (27%). Animals that had cleared HCV infection lacked antibody to E2 but had about the same percentage of reactivity to E1 as persistently infected animals. These data would suggest that viral clearance was not due to neutralizing antibody to either E1 or E2.
To evaluate the relation between chronic infection and sequence changes in the E2 HVR due to the selection of immune escape variants, the HVR1 was cloned and sequenced from 10 chronically infected animals. The animals were not selected based on any virological or clinical finding; they were selected on the sole basis that they were long-time chronic carriers for which bleeds were available. The sequence was obtained for an early bleed during acute infection and a recent bleed that was 2 to 8 yr after infection. No significant sequence divergence in HVR1 was observed in these animals irrespective of an antibody response to E2, suggesting that viral persistence in these animals was due to mechanisms other than immune escape after mutation of HVR1 (Bassett et al. 1999b). The 10 animals had been infected with four different strains of HCV and considerable divergence in the HVR1 was observed between different strains, confirming that this region is highly variable from one strain to the next; yet no divergence over time occurred in the chimpanzees. This finding was extended and confirmed using a larger group of animals and analysis of a larger sequence domain. The major variant in the quasispecies was unaltered even after eight serial passages in chimpanzees (Ray et al. 2000).
CD4+ T Cell Responses
In humans and chimpanzees, CD4+ T cells appear to be important in the clearance of HCV infection. Proliferative responses of peripheral blood mononuclear cells (PBMCs1) to recombinant HCV antigens are generally performed to detect HCV-specific CD4+ T cell activity. Several studies have suggested an association between a vigorous CD4+ T cell response to HCV proteins and viral clearance in humans during the acute phase of infection (Diepolder et al. 1996, 1997; Lechner et al. 2000; Missale et al. 1996; Takaki et al. 2000; Tsai et al. 1997b). In humans, CD4+ T cell responses associated with viral clearance are targeted toward the nonstructural proteins. A strong response to NS3 may be particularly critical in the resolution of acute hepatitis C (Diepolder et al. 1997). The cytokine profiles of HCV-specific CD4+ cells of individuals that clear the virus display a T-helper type I profile ( Lechner et al. 2000; Tsai et al. 1997b).
The HCV-specific CD4+ T cell response in chimpanzees has not been studied in detail. We are currently evaluating the relation of disease outcome in HCV-inoculated chimpanzees to the ability of CD4+ T cells to recognize various HCV proteins. We are investigating the following groups of chimpanzees: (1) persistently infected chimpanzees, (2) acutely infected chimpanzees, and (3) chimpanzees that previously cleared HCV and were rechallenged with homologous or heterologous virus. We assessed the response to core, NS3, NS4, and NS5 antigens using PBMC and standard proliferation assays (antigens were kindly provided by Chiron Corp., Emeryville, California). Persistently infected chimpanzees did not have detectable proliferative responses in our assays, and some acutely infected animals destined to clear the virus exhibited weak and transient T cell proliferative responses to NS3-NS4. In contrast, rechallenge of animals that had previously cleared infection resulted in a very rapid and strong proliferative response to the nonstructural proteins. Proliferative responses to NS3-NS4 were detected in each animal by week 2 after rechallenge. A typical proliferative response profile from these animals is illustrated in Figure 4. The rapid proliferative responses were also associated with rapid viral clearance. No viremia was detected in one animal upon rechallenge, although intrahepatic viral RNA was detected for 1 wk, and a second animal cleared viremia by week 4. A rapid increase in anti-HCV antibody titer was also noted in these animals. Although the proliferative responses waned, weak proliferation to NS3-NS4 was observed 22 wk after inoculation in one animal.
These preliminary data suggest that memory T cells contribute to a long-lasting, protective immune response in chimpanzees that clear HCV. Additionally, NS3-NS4 may be a good vaccine candidate because T cell responses to HCV nonstructural proteins appear to coincide with viral clearance and because memory T cell responses to the nonstructural proteins appear to be elicited even when a divergent strain of HCV is introduced.
CD8+ T Cell Responses
HCV antigen-specific CD8+ T cells have been observed in the peripheral blood and liver of humans and chimpanzees during HCV infection (Rehermann and Chisari 2000). HCV-specific CD8+ T cells appear to be present at higher frequencies in the liver compared with PBMC because they can be isolated from the liver using antigen-nonspecific stimuli (Cooper et al. 1999; Giuggio et al. 1998; Koziel et al. 1993; Wong et al. 1998). Chimpanzees have been useful in studying the role of CD8+ T cells in HCV infection (Cooper et al. 1999; Erickson et al. 193; Kowalski et al. 1996; Walker 1997; Weiner et al. 1995). Animals that cleared HCV produced an early and broad intrahepatic CD8+ T cell response to multiple HCV epitopes, suggesting that an early and broad intrahepatic CD8+ T cell response is involved in preventing viral persistence (Cooper et al. 1999). Similar to the findings in chimpanzees, a strong and persistent T cell response appears to be critical for viral clearance in humans and is also observed in HCV-seronegative humans with frequent exposure to HCV (Bronowicki et al. 1997; Grüner et al. 2000; Koziel et al. 1997; Lechner et al. 2000). The value of the chimpanzee model for the analysis of immune responses to viral infection and development of vaccines is increased by the observation that overlap exists between humans and chimpanzees in recognition of class I-restricted CTL epitopes (Bertoni et al. 1998).
The majority of CTL studies have focused on the immune response from chronically infected humans and chimpanzees. HCV-specific CTL responses appear to be multispecific in most patients. Although CD8+ T cells can be measured in chronically infected individuals, they appear to be too weak to clear the virus. T cell escape variants may also be involved in persistence of HCV (Chang et al. 1997; Eckels et al. 1999; Weiner et al. 1995). HCV-specific CTL probably control HCV replication to some extent inasmuch as multiple studies have demonstrated that stronger HCV-specific CTL activity was associated with lower viral loads (Hiroishi et al. 1997; Nelson et al. 1997; Rehermann et al. 1996).
Pathogenesis of HCV Infections in Chimpanzees and Impact of Elevated Iron Levels
In general, it has been assumed that the chimpanzee is a valuable model for some aspects of HCV, but that little disease progression is observed. Although fibrosis and cirrhosis have not been observed in chimpanzees, two cases of HCV-associated hepatocellular carcinoma have been observed (Muchmore et al. 1988; R. E. L., unpublished data). In considering pathogenesis in the chimpanzee model, it must be considered that very few animals have been infected for more than 10 yr, disease progression in humans is often uneventful for several decades, and the percentage of humans that will actually progress to significant disease is still controversial. Long-term follow-up (average 18 yr) of patients with transfusion-associated HCV and matched controls revealed identical survival curves with a small but significant increase in liver disease-related deaths (Seeff et al. 1992). In a separate study, a 45-yr follow-up of 17 HCV-positive military recruits revealed that only two had developed liver disease (Seeff et al. 2000).
In addition to the limited number of animals with a long duration of infection, a number of critical environmental factors may be lacking in the chimpanzee model, such as alcohol consumption and increased dietary iron levels. Although it would not be ethical to place chimpanzees on prolonged high alcohol diets, the role of increased dietary iron could be evaluated. Studies in human populations have suggested that HCV chronic carriers have elevated serum iron content (Arber et al. 1994; Bonkovsky et al. 1997; Di Bisceglie et al. 1992; Riggio et al. 1997) and, that increased iron is associated with increased serum ALT and decreased interferon (IFN1) response (Bonkovsky et al. 1997; Di Bisceglie et al. 1992; Haque et al. 1996; Henkler et al. 1995; Ikura et al. 1996; Kageyama et al. 1998; Olynyk et al. 1995; Riggio et al. 1997; Tsai et al. 1997a; Van Thiel et al. 1994). Phlebotomy to reduce iron levels has been shown to decrease serum ALT level and liver histological activity and to increase the response to IFN (Bacon et al. 1993; Bonkovsky et al. 1997; Fong et al. 1998; Guyader et al. 1999; Hayashi et al. 1994; Riggio et al. 1997; Tsai et al. 1997a).
However, it is not clear whether HCV infection causes increased iron accumulation by the liver, which increases pathogenesis, or whether pre-existing high iron levels in the host increase HCV pathogenesis. To better understand the relation between iron and persistent HCV infections, we examined the effect of excess dietary iron on disease severity in HCV-infected chimpanzees (Bassett et al. 1999a). Iron was supplemented in the diets of HCV-infected and uninfected chimpanzees for 29 wk to achieve iron loading. Iron loading was confirmed by increases in serum iron levels, percentages of transferrin saturation, ferritin levels, elevations in hepatic iron concentration, and histological examination. HCV-infected chimpanzees tended to have higher iron levels before iron feeding than uninfected animals. Although various degrees of iron loading occurred in all chimpanzees, iron overload increased more readily during iron feeding and decreased less readily during follow-up in HCV-infected animals in comparison with controls. Iron loading did not influence the viral load but did exacerbate liver injury in HCV-infected chimpanzees, as evidenced by elevated ALT and liver histological changes. Because all chimpanzees on high iron diets experienced iron loading but pathological effects were observed only in HCV-infected chimpanzees, HCV infection appears to increase the susceptibility of the liver to injury after iron loading. These results confirm the association of increased iron and pathogenesis in HCV-infected humans and suggest that the lack of disease progression in HCV-infected chimpanzees may be due in part to the lack of specific environmental factors.
Development of Infectious cDNA Clones
The development of infectious cDNA clones of HCV proved to be a particularly arduous task for a number of reasons. Initial attempts failed due to the lack of the 3' terminal sequence. The cloning of the 3' terminus of HCV was hampered due to the low levels of starting RNA for amplification and the lack of a polyA tail from which to prime cDNA synthesis (Blight and Rice 1997; Kolykhalov et al. 1996; Tanaka et al. 1995, 1996). However, even after the entire sequence was available, the validation of infectious clones was not straightforward. In the absence of a tissue culture system, the only assay for infectivity was the direct intrahepatic inoculation of a chimpanzee with synthetic RNA derived from the clones. Kolykhalov et al (1997) inoculated 34 full-length clones into chimpanzees without identification of an infectious clone. Ultimately, the first infectious clones were produced by making a chimeric sequence that represented the consensus of multiple full-length sequences from the same starting material (Kolykhalov et al. 1997; Yanagi et al. 1997). Subsequently, several infectious clones were produced by correcting nonconsensus residues identified by alignment with unrelated HCV sequences present in GenBank (Beard et al. 1999; Hong et al. 1999; Lanford et al. 2001).
The development of infectious cDNA clones of the virus has provided a number of new opportunities in HCV research including reverse genetics for analysis of sequence motifs essential for replication. However, in the absence of a tissue culture system, the testing of mutant clones is still restricted to the intrahepatic inoculation of chimpanzees with synthetic RNA (Kolykhalov et al. 2000; Yanagi et al. 1999). The expense of performing such studies in chimpanzees obviously limits the application of reverse genetics to analysis of HCV replication at the time of this writing. The recent description of a replicon system for HCV RNA (Lohmann et al. 1999) suggests that advances in the genetic analysis of HCV replication should be attained in the near future; however, the development of replicons with other strains of HCV have not met with immediate success.
Analysis of Changes in Liver Gene Expression in HCV Infection with DNA Microarray Technology
We are currently using DNA microarrays in an effort to understand the mechanism of viral clearance in chimpanzees at the molecular level. With this technology, the liver of an infected animal can be probed for changes in gene expression at multiple time points during the acute phase of infection and through viral clearance. DNA microarrays provide a powerful tool for the direct monitoring of changes in expression for large numbers of mRNAs in parallel, controlled experiments. RNA extracted from target tissue or cells is used to generate cDNA, which is hybridized directly to the array or is used to prepare cRNA for hybridization. Our studies were conducted with the Affymetrix Human FL DNA microarray, which contains oligonucleotides (oligos1) representative of approximately 6800 genes. Each gene is represented by a series of individual oligos, usually 20 oligos per gene; and for each oligo, there is an oligo with a single mismatched base that serves as a control for specificity. Thus, the expression level for each gene is based on the hybridization with 40 individual oligos.
Perhaps the most exciting utilization of microarray technology is the analysis of changes in gene expression associated with infectious diseases. Microarrays have been used to analyze changes in cellular gene expression associated with infection of tissue culture cells with human immunodeficiency virus, human papilloma virus, and human cytomegalovirus (Chang and Laimins 2000; Geiss et al. 2000; Zhu et al. 1998). These studies have revealed that a relatively small number of genes (e.g., 258 for human cytomegalovirus) changed in response to viral infection, indicating that the technique provides a useful and manageable volume of data.
Our analysis of an HCV-infected chimpanzee liver represented the first use of this technology to examine the progressive changes in an infectious disease in an animal model (C. B. and R. E. L., unpublished data). We anticipated three types of changes in gene expression in the liver as a consequence of HCV infection: (1) changes due to interactions between the hepatocyte and HCV proteins; (2) changes due to the endogenous antiviral response of the liver (e.g., induction of IFNa and IFN-response genes; and (3) changes due to the innate and adaptive immune response to the infection (e.g., activation and infiltration of NK cells, macrophages, and lymphocytes and the hepatocyte response to the cytokines expressed by these cells). The animal chosen for the first analysis exhibited a very rapid, biphasic clearance profile. Although clearance of viral RNA from the liver did not occur until week 16, viremia was cleared by week 8. This biphasic clearance pattern suggested that different mechanisms may be operative in cessation of viral replication (clearance of viremia) and elimination of residual infected hepatocytes (clearance of viral RNA from the liver). Maximum serum ALT values (indicative of liver damage) and seroconversion for anti-HCV antibody occurred at week 6. DNA microarray analysis was conducted on liver tissue obtained before infection and at multiple time points through week 16.
We detected the expression of 2300 genes, of which 223 exhibited a fold change in expression of ³ 3.5 before clearance of viremia. The progression in the number of genes with changes in expression and the increases in the magnitude of the changes are illustrated in Table 1. Very few genes were altered 2 days after infection, indicating that spurious changes unrelated to HCV infection did not present a problem in the analysis. A progressive increase in the number of genes with altered expression occurred until the peak in ALT rise. Changes were observed in metabolic genes, cell cycle regulation genes, apoptotic markers, and immune response genes. The earliest and the greatest magnitude in changes were observed in the interferon-response genes, some of which were elevated in expression by ³ 90. Most of these changes were probably in response to IFNa secretion by infected hepatocytes. Although the IFN response appeared to be involved in the clearance of viremia, viral RNA persisted in the liver for 8 wk after the clearance of viremia. Presumably, a specific T cell response was involved in the destruction of the residual infected cells. The data suggest that hepatocytes may be responding to IFNa (and other cytokines) by creating an environment that is incompatible with viral replication, thus resulting in spread and persistence of the infection.
These preliminary data provide insight in to the response of the liver to a hepatotropic viral infection, the mechanism of viral clearance, and the underlying causes of pathology. These results will open productive avenues for future studies on the mechanism of viral clearance and persistence in HCV-infected humans.
Acknowledgments
1Abbreviations used in this article: ALT, alanine transaminase; CTL, cytotoxic T lymphocyte; HCV, hepatitis C virus; HVR, hypervariable region; IFN, interferon; NANBH, non-A, non-B hepatitis; NS, nonstructural; oligo, oligonucleotide; PBMC, peripheral blood mononuclear cell; SFBR, Southwest Foundation for Biomedical Research; UTR, untranslated region.
This work was supported by National Institutes of Health grants U19 AI40035 and P51 RR13986.
References
Ahmed A, Keeffe EB. 1999. Treatment strategies for chronic hepatitis C: Update since the 1997 National Institutes of Health Consensus Development Conference. J Gastroenterol Hepatol 14:S12-S18
Alter HJ. 1995. To C or not to C: These are the questions. J Am Soc Hematol 85:1681-1695.
Alter MJ, Kruszon-Moran D, Nainan OV, McQuillan GM, Gao FX, Moyer LA, Kaslow RA, Margolis HS. 1999. The prevalence of hepatitis C virus infection in the United States, 1988 through 1994. N Engl J Med 341:556-562.
Anonymous. 1997. Hepatitis C: Global prevalence. Wkly Epidemiol Rec 72:341-344.
Arber N, Konikoff FM, Moshkowitz M, Baratz M, Hallak A, Santo M, Halpern Z, Weiss H, Gilat T. 1994. Increased serum iron and iron saturation without liver iron accumulation distinguish chronic hepatitis C virus from other chronic liver diseases. Dig Dis Sci 39:2656-2659.
Bacon BR, Rebholz AE, Fried M, DiBisceglie AM. 1993. Beneficial effect of iron reduction therapy in patients with chronic hepatitis C who failed to respond to interferon-alpha (Abstract). Hepatology 18:90A.
Barrett S, Ryan E, Crowe J. 1999. Association of the HLA-DRB1*01 allele with spontaneous viral clearance in an Irish cohort infected with hepatitis C virus via contaminated anti-D immunoglobulin. J Hepatol 30:979-983.
Bassett SE, Brasky KM, Lanford RE. 1998. Analysis of hepatitis C virus-inoculated chimpanzees reveals unexpected clinical profiles. J Virol 72:2589-2599.
Bassett SE, DiBisceglie AM, Bacon BR, Sharp RM, Govindarajan S, Hubbard GB, Brasky KM, Lanford RE. 1999a. Effects of iron loading on pathogenicity in hepatitis C virus-infected chimpanzees. Hepatology 29:1884-1892.
Bassett SE, Thomas DL, Brasky KM, Lanford RE. 1999b. Viral persistence, antibody to E1 and E2, and hypervariable region 1 sequence stability in hepatitis C virus-inoculated chimpanzees. J Virol 73:1118-1126.
Beard MR, Abell G, Honda M, Carroll A, Gartland M, Clarke B, Suzuki K, Lanford R, Sangar DV, Lemon SM. 1999. An infectious molecular clone of a Japanese genotype 1b hepatitis C virus. Hepatology 30:316-324.
Bertoni R, Sette A, Sidney J, Guidotti LG, Shapiro M, Purcell R, Chisari FV. 1998. Human class I supertypes and CTL repertoires extend to chimpanzees. J Immunol 161:4447-4455.
Blight KJ, Rice CM. 1997. Secondary structure determination of the conserved 98-base sequence at the 3' terminus of hepatitis C virus genome RNA. J Virol 71:7345-7352.
Bonkovsky H, Banner BF, Rothman AL. 1997. Iron and chronic viral hepatitis. Hepatology 25:759-768.
Bronowicki JP, Vetter D, Uhl G, Hudziak H, Uhrlacher A, Vetter JM, Doffoel M. 1997. Lymphocyte reactivity to hepatitis C virus (HCV) antigens shows evidence for exposure to HCV in HCV-seronegative spouses of HCV- infected patients. J Infect Dis 176:518-522.
Bukh J, Apgar CL, Engle R, Govindarajan S, Hegerich PA, Tellier R, Wong DC, Elkins R, Kew MC. 1998. Experimental infection of chimpanzees with hepatitis C virus of genotype 5a: Genetic analysis of the virus and generation of a standardized challenge pool. J Infect Dis 178:1193-1197.
Chang KM, Rehermann B, McHutchison JG, Pasquinelli C, Southwood S, Sette A, Chisari FV. 1997. Immunological significance of cytotoxic T lymphocyte epitope variants in patients chronically infected by the hepatitis C virus. J Clin Invest 100:2376-2385.
Chang YE, Laimins LA. 2000. Microarray analysis identifies interferon-inducible genes and Stat-1 as major transcriptional targets of human papillomavirus type 31. J Virol 74:4174-4182.
Choo Q-L, Kuo G, Ralston R, Weiner A, Chien D, Van Nest G, Han J, Berger K, Thudium K, Kuo C, Kansopon J, McFarland J, Tabrizi A, Ching K, Moss B, Cummins LB, Houghton M, Muchmore E. 1994. Vaccination of chimpanzees against infection by the hepatitis C virus. Proc Natl Acad Sci U S A 91:1294-1298.
Choo Q-L, Kuo G, Weiner AJ, Overby LJ, Bradley DW, Houghton M. 1989. Isolation of a cDNA clone derived from blood-borne non-A, non-B viral hepatitis genome. Science 244:359-362.
Cooper S, Erickson AL, Adams EJ, Kansopon J, Weiner AJ, Chien DY, Houghton M, Parham P, Walker CM. 1999. Analysis of a successful immune response against hepatitis C virus. Immunity 10:439-449.
Di Bisceglie AM, Axiotis CA, Hoofnagle JH, Bacon BR. 1992. Measurements of iron status in patients with chronic hepatitis. Gastroenterology 102:2108-2113.
Diepolder HM, Gerlach J, Zachoval R, Hoffmann RM, Jung M-C, Wierenga EA, Scholz S, Santantonio T, Houghton M, Southwood S, Sette A, Pape GR. 1997. Immunodominant CD4+ T-Cell eptiope within nonstructural protein 3 in acute hepatitis C virus infection. J Virol 71:6011-6019.
Diepolder HM, Zachoval R, Hoffmann RM, Jung MC, Gerlach T, Pape GR. 1996. The role of hepatitis C virus specific CD4+ T lymphocytes in acute and chronic hepatitis C. J Mol Med 74:583-588.
Eckels DD, Zhou H, Bian TH, Wang H. 1999. Identification of antigenic escape variants in an immunodominant epitope of hepatitis C virus. Int Immunol 11:577-583.
Erickson AL, Houghton M, Choo Q-L, Weiner AJ, Ralston R, Muchmore E. 1993. Hepatitis C virus-specific CTL responses in the liver of chimpanzees with acute and chronic hepatitis C. J Immunol 151:4189-4199.
Farci P, Alter HJ, Wong DC, Miller RH, Govindarajan S, Engle R, Shapiro M, Purcell RH. 1994. Prevention of hepatitis C virus infection in chimpanzees after antibody-mediated in vitro neutralization. Proc Natl Acad Sci U S A 91:7792-7796.
Farci P, Shimoda A, Wong D, Cabezon T, De Gioannis D, Strazzera A, Shimizu Y, Shapiro M, Alter HJ, Purcell RH. 1996. Prevention of hepatitis C virus infection in chimpanzees by hyperimmune serum against the hypervariable region 1 of the envelope 2 protein. Proc Natl Acad Sci U S A 93:15394-15399.
Fong TL, Han SH, Tsai NC, Morgan TR, Mizokami M, Qian DJ, Phan C, Goad K, Redeker AG. 1998. A pilot randomized, controlled trial of the effect of iron depletion on long-term response to a -interferon in patients with chronic hepatitis C. J Hepatol 28:369-374.
Forns X, Purcell RH, Bukh J. 1999. Quasispecies in viral persistence and pathogenesis of hepatitis C virus. Trends Microbiol 7:402-410.
Geiss GK, Bumgarner RE, An MC, Agy MB, van 't W, Hammersmark E, Carter VS, Upchurch D, Mullins JI, Katze MG. 2000. Large-scale monitoring of host cell gene expression during HIV-1 infection using cDNA microarrays. Virology 266:8-16.
Giuggio VM, Bonkovsky HL, Smith J, Rothman AL. 1998. Inefficient recognition of autologous viral sequences by intrahepatic hepatitis C virus-specific cytotoxic T lymphocytes in chronically infected subjects. Virology 251:132-140.
Grüner NH, Gerlach TJ, Jung MC, Diepolder HM, Schirren CA, Schraut WW, Hoffmann R, Zachoval R, Santantonio T, Cucchiarini M, Cerny A, Pape GR. 2000. Association of hepatitis C virus-specific CD8+ T cells with viral clearance in acute hepatitis C. J Infect Dis 181:1528-1536.
Guyader D, Boucher E, André P, Even C, Cottereau J, Bianchi A, Gasser P, Mendler MH, Deugnier Y, Brissot P. 1999. A pilot study of iron depletion as adjuvant therapy in chronic hepatitis C patients not responding to interferon. Am J Gastroenterol 94:1696-1698.
Haque S, Chandra B, Gerber MA, Lok ASF. 1996. Iron overload in patients with chronic hepatitis C: A clinicopathologic study. Hum.Pathol. 27:1277-1281.
Hayashi H, Takikawa T, Nishimura N, Yano M, Isomura T, and Sakamoto N. 1994. Improvement of serum aminotransferase levels after phlebotomy in patients with chronic active hepatitis C and excess hepatic iron. Am J Gastroenterol 89:986-988.
Henkler F, Waseem N, Golding MHC, Alison MR, Koshy R. 1995. Mutant p53 but not hepatitis B virus X protein is present in hepatitis B virus-related human hepatocellular carcinoma. Cancer Res 55:6084-6091.
Hiroishi K, Kita H, Kojima M, Okamoto H, Moriyama T, Kaneko T, Ishikawa T, Ohnishi S, Aikawa T, Tanaka N, Yazaki Y, Mitamura K, Imawari M. 1997. Cytotoxic T lymphocyte response and viral load in hepatitis C virus infection. Hepatology 25:705-712.
Honda M, Beard MR, Ping LH, Lemon SM. 1999. A phylogenetically conserved stem-loop structure at the 5' border of the internal ribosome entry site of hepatitis C virus is required for cap-independent viral translation. J Virol 73:1165-1174.
Hong Z, Beaudet-Miller M, Lanford RE, Guerra B, Wright-Minogue J, Skelton A, Baroudy BM, Reyes GR, Lau JY. 1999. Generation of transmissible hepatitis C virions from a molecular clone in chimpanzees. Virology 256:36-44.
Hoofnagle JH. 1997. Hepatitis C: The clinical spectrum of disease. Hepatology 26(Suppl):15S-20S.
Houghton M, Selby M, Weiner A, Choo QL. 1994. Hepatitis C virus: structure, protein products and processing of the polyprotein precursor. Curr Stud Hematol Blood Transfus 61:1-11.
Houghton M, Weiner A, Han J, Kuo G, Choo Q-L. 1991. Molecular biology of the hepatitis C viruses: Implications for diagnosis, development and control of disease. Hepatology 14:381-388.
Ikura Y, Morimoto H, Johmura H, Fukui M, Sakurai M. 1996. Relationship between hepatic iron deposits and response to interferon in chronic hepatitis C. Am J Gastroenterol 91:1367-1373.
Kageyama F, Kobayashi Y, Murohisa G, Shimizu E, Suzuki F, Kikuyama M, Souda K, Kawasaki T, Nakamura H. 1998. Failure to respond to interferon-a 2a therapy is associated with increased hepatic iron levels in patients with chronic hepatitis C. Biol Trace Elem Res 64:185-196.
Kato N, Ootsuyama Y, Tanaka T, Nakagawa M, Nakazawa T, Muraiso K, Ohkoshi S, Hijikata M, Shimotohno K. 1992. Marked sequence diversity in the putative envelope proteins of hepatitis C viruses. Virus Res 22:107-123.
Kato N, Sekiya H, Ootsuyama Y, Nakazawa T, Hijikata M, Ohkoshi S, Shimotohno K. 1993. Humoral immune response to hypervariable region 1 of the putative envelope glycoprotein (gp70) of hepatitis C virus. J Virol 67:3923-3930.
Kolykhalov AA, Agapov EV, Blight KJ, Mihalik K, Feinstone SM, Rice CM. 1997. Transmission of hepatitis C by intrahepatic inoculation with transcribed RNA. Science 277:570-574.
Kolykhalov AA, Feinstone SM, Rice CM. 1996. Identification of a highly conserved sequence element at the 3' terminus of hepatitis C virus genome RNA. J Virol 70:3363-3371.
Kolykhalov AA, Mihalik K, Feinstone SM, Rice CM. 2000. Hepatitis C virus-encoded enzymatic activities and conserved RNA elements in the 3' nontranslated region are essential for virus replication in vivo. J Virol 74:2046-2051.
Kowalski H, Erickson AL, Cooper S, Domena JD, Parham P, Walker CM. 1996. Patr-A and B, the orthologues of HLA-A and B, present hepatitis C virus epitopes to CD8+ cytotoxic T cells from two chronically infected chimpanzees. J Exp Med 183:1761-1775.
Koziel MJ, Dudley D, Afdhal N, Grakoui A, Rice CM, Choo Q-L, Houghton M, Walker BD. 1993. Hepatitis C virus (HCV)-specific cytotoxic T lymphocytes recognize epitopes in the core and envelope proteins of HCV. J Virol 67:7522-7532.
Koziel MJ, Wong DKH, Dudley D, Houghton M, Walker BD. 1997. Hepatitis C virus-specific cytolytic T lymphocyte and T helper cell responses in seronegative persons. J Infect Dis 176:859-866.
Krawczynski K, Alter MJ, Tankersley DL, Beach M, Robertson BH, Lambert S, Kuo G, Spelbring JE, Meeks E, Sinha S, Carson DA. 1996. Effect of immune globulin on the prevention of experimental hepatitis C virus infection. J Infect Dis 173:822-828.
Lanford RE, Lee H. Chavez D. Guerra B, Brasky KM. 2001. An infectious clone of the HCV-1 prototype sequence. J Gen Virol (In Press).
Lechner F, Wong DK, Dunbar PR, Chapman R, Chung RT, Dohrenwend P, Robbins G, Phillips R, Klenerman P, Walker BD. 2000. Analysis of successful immune responses in persons infected with hepatitis C virus. J Exp Med 191:1499-1512.
Lohmann V, Körner F, Koch JO, Herian U, Theilmann L, Bartenschlager R. 1999. Replication of subgenomic hepatitis C virus RNAs in a hepatoma cell line. Science 285:110-113.
Missale G, Bertoni R, Lamonaca V, Valli A, Massari M, Mori C, Rumi MG, Houghton M, Fiaccadori F, Ferrari C. 1996. Different clinical behaviors of acute hepatitis C virus infection are associated with different vigor of the anti-viral cell-mediated immune response. J Clin Invest 98:706-714.
Muchmore E, Popper H, Peterson DA, Miller MF, Lieberman HM. 1988. Non-A, non-B hepatitis-related hepatocellular carcinoma in a chimpanzee. J Med Primatol 17:235-246.
Nelson DR, Marousis CG, Davis GL, Rice CM, Wong J, Houghton M, Lau JYN. 1997. The role of hepatitis C virus-specific cytotoxic T lymphocytes in chronic hepatitis C. J Immunol 158:1473-1481.
NIH [National Institutes of Health]. 1997. National Institutes of Health Consensus Development Conference Panel statement: Management of hepatitis C. Hepatology 26(Suppl):2S-10S.
Okamoto H, Kojima M, Okada S-I, Yoshizawa H, Iizuka H, Tanaka T, Muchmore EE, Peterson DA, Ito Y, Mishiro S. 1992. Genetic drift of hepatitis C virus during an 8.2-year infection in a chimpanzee: Variability and stability. Virology 190:894-899.
Olynyk JK, Reddy KR, Di Bisceglie AM, Jeffers LJ, Parker TI, Radick JL, Schiff ER, Bacon BR. 1995. Hepatic iron concentration as a predictor of response to interferon alfa therapy in chronic hepatitis C. Gastroenterology 108:1104-1109.
Prince AM, Brotman B. 1994. The biology of hepatitis C virus infection. Curr Stud Hematol Blood Transfus 61:195-207.
Ray SC, Mao Q, Lanford RE, Bassett S, Laeyendecker O, Wang YM, Thomas DL. 2000. Hypervariable region 1 sequence stability during hepatitis C virus replication in chimpanzees. J Virol 74:3058-3066.
Ray SC, Wang YM, Laeyendecker O, Ticehurst JR, Villano SA, Thomas DL. 1999. Acute hepatitis C virus structural gene sequences as predictors of persistent viremia: Hypervariable region 1 as a decoy. J Virol 73:2938-2946.
Reed KE, Rice CM. 1998. Molecular characterization of hepatitis C virus. Curr Stud Hematol Blood Transfus 1-37.
Rehermann B, Chang KM, McHutchison J, Kokka F, Houghton M, Rice CM, Chisari FV. 1996. Differential cytotoxic T-lymphocyte responsiveness to the hepatitis B and C viruses in chronically infected patients. J Virol 70:7092-7102.
Rehermann B, Chisari FV. 2000. Cell mediated immune response to the hepatitis C virus. Curr Top Microbiol Immunol 242:299-325.
Riggio O, Montagnese F, Fiore P, Folino S, Giambartolomei S, Gandin C, Merli M, Quinti I, Violante N, Caroli S, Senofonte O, Capocaccia L. 1997. Iron overload in patients with chronic viral hepatitis: How common is it? Am J Gastroenterol 92:1298-1301.
Robertson B, Myers G, Howard C, Brettin T, Bukh J, Gaschen B, Gojobori T, Maertens G, Mizokami M, Nainan O, Netesov S, Nishioka K, Shin, Simmonds P, Smith D, Stuyver L, Weiner A. 1998. Classification, nomenclature, and database development for hepatitis C virus (HCV) and related viruses: Proposals for standardization. International Committee on Virus Taxonomy. Arch Virol 143:2493-2503.
Scognamiglio P, Accapezzato D, Casciaro MA, Cacciani A, Artini M, Bruno G, Chircu ML, Sidney J, Southwood S, Abrignani S, Sette A, Barnaba V. 1999. Presence of effector CD8+ T cells in hepatitis C virus-exposed healthy seronegative donors. J Immunol 162:6681-6689.
Seeff LB, Buskell-Bales Z, Wright EC, Durako SJ, Alter HJ, Iber FL, Hollinger FB, Gitnick G, Knodell RG, Perrillo RP, Stevens CE, Hollingsworth CG. 1992. Long-term mortality after tranfusion-associated non-A, non-B hepatitis. N Engl J Med 327:1906-1911.
Seeff LB, Miller RN, Rabkin CS, Buskell-Bales Z, Straley-Eason KD, Smoak BL, Johnson LD, Lee SR, Kaplan EL. 2000. 45-year follow-up of hepatitis C virus infection in healthy young adults. Ann Int Med 132:105-111.
Takaki A, Wiese M, Maertens G, Depla E, Seifert U, Liebetrau A, Miller JL, Manns MP, Rehermann B. 2000. Cellular immune responses persist and humoral responses decrease two decades after recovery from a single-source outbreak of hepatitis C. Nat Med 6:578-582.
Tanaka T, Kato N, Cho MJ, Shimotohno K. 1995. A novel sequence found at the 3' terminus of hepatitis C virus genome. Biochem Biophys Res Commun 215:744-749.
Tanaka T, Kato N, Cho MJ, Sugiyama K, Shimotohno K. 1996. Structure of the 3' terminus of the hepatitis C virus genome. J Virol 70 :3307-3312.
Taniguchi S, Okamoto H, Sakamoto M, Kojima M, Tsuda F, Tanaka T, Munekata E, Muchmore EE, Peterson DA, Mishiro S. 1993. A structurally flexible and antigenically variable N-terminal domain of the hepatitis C virus E2/NS1 protein: Implication for an escape from antibody. Virology 195:297-301.
Tsai NCS, Zuckerman E, Han SH, Goad K, Redeker AG, Fong TL. 1997a. Effect of iron depletion on long-term response to interferon-a in patients with chronic hepatitis C who previously did not respond to interferon therapy. Am J Gastroenterol 92:1831-1834.
Tsai SL, Liaw YF, Chen MH, Huang CY, Kuo GC. 1997b. Detection of type 2-like T-helper cells in hepatitis C virus infection: Implications for hepatitis C virus chronicity. Hepatology 25:449-458.
Van Thiel DH, Friedlander L, Faginoli S, Wright HI, Irish W, Gavaler JS. 1994. Response to interferon alpha-therapy is influenced by the iron content of the liver. J Hepatol 20:410-415.
Walker CM. 1997. Comparative features of hepatitis C virus infection in humans and chimpanzees. Springer Semin Immunopathol 19:85-98.
Weiner A, Erickson AL, Kansopon J, Crawford K, Muchmore E, Hughes AL, Houghton M, Walker CM. 1995. Persistent hepatitis C virus infection in a chimpanzee is associated with emergence of a cytotoxic T lymphocyte escape variant. Proc Natl Acad Sci U S A 92:2755-2759.
Weiner AJ, Brauer MJ, Rosenblatt J, Richman KH, Tung J, Crawford K, Bonino F, Saracco G, Choo QL, Houghton M, Han JH. 1991. Variable and hypervariable domains are found in the regions of HCV corresponding to the flavivirus envelope and NS1 proteins and the pestivirus envelope glycoproteins. Virology 180:842-848.
Weiner AJ, Geysen M, Christopherson C, Hall JE, Mason TJ, Saracco G, Bonino F, Crawford K, Marion CD, Crawford KA, Brunetto M, Barr PJ, Miyamura T, McHutchinson J, Houghton M. 1992. Evidence for immune selection of hepatitis C virus (HCV) putative envelope glycoprotein variants: Potential role in chronic HCV infections. Proc Natl Acad Sci U S A 89:3468-3472.
Wong DK, Dudley DD, Afdhal NH, Dienstag J, Rice CM, Wang LP, Houghton M, Walker BD, Koziel MJ. 1998. Liver-derived CTL in hepatitis C virus infection: Breadth and specificity of responses in a cohort of persons with chronic infection. J Immunol 160:1479-1488.
Yanagi M, Purcell RH, Emerson SU, Bukh J. 1997. Transcripts from a single full-length cDNA clone of hepatitis C virus are infectious when directly transfected into the liver of a chimpanzee. Proc Natl Acad Sci U S A 94:8738-8743.
Yanagi M, St Claire M, Emerson SU, Purcell RH, Bukh J. 1999. In vivo analysis of the 3' untranslated region of the hepatitis C virus after in vitro mutagenesis of an infectious cDNA clone. Proc Natl Acad Sci U S A 96:2291-2295.
Zhu H, Cong JP, Mamtora G, Gingeras T, Shenk T. 1998. Cellular gene expression altered by human cytomegalovirus: Global monitoring with oligonucleotide arrays. Proc Natl Acad Sci U S A 95:14470-14475.
Figure 1 Genome structure of hepatitis C virus, depicted with the polyprotein open reading frame (rectangle) bordered by the 5' untranslated region containing the internal ribosome entry site (IRES) and the 3' untranslated region containing the polyU/polypyrimidine stretch (U/PP) and the highly conserved 101-nucleotide (nt) terminal sequence. The protein domains are designated along with the cleavage sites used to generate the individual proteins.
Figure 2 Clinical outcome of hepatitis C virus (HCV) infection in a chimpanzee cohort. HCV status of the chimpanzee colony at the Southwest Regional Primate Research Center at the Southwest Foundation for Biomedical Research at the time of this writing. During the past 20 yr, 52 of the 249 chimpanzees were inoculated with various non-A, non-B hepatitis (NANBH) and HCV inocula. Prior HCV infection was confirmed in 46 animals. Serum samples were evaluated for HCV RNA by reverse transcription/polymerase chain reaction (RT/PCR) analysis and for anti-HCV antibody (Ab) by enzyme-linked immunosorbent assay. Chimpanzees were classified as PCR-Ab-, PCR+Ab+, or PCR-Ab+. HCV infection was confirmed in 24 of the animals currently PCR-Ab- using archived serum samples, and six animals in which infection could not be confirmed were excluded.
Figure 3 Hepatitis C virus (HCV) rapid viral clearance profile in a chimpanzee. A chimpanzee was inoculated with HCV and was monitored for increases in serum alanine aminotransferase (ALT) levels, viral RNA by quantitative, real-time (TaqMan) reverse transcription/polymerase chain reaction (RT/PCR), and seroconversion for anti-HCV antibodies. The TaqMan primers and probe were from the 5' untranslated region and were: forward primer, 5' TGCGGAACCGGTGAGTACA; reverse primer, 5' CGGGTTTATCCAAGAAAGGA; and probe, 5' CCGGTCGTCCTGGCAATTCCG (Lanford et al. 2000). Reverse transcription and amplification were performed using TaqMan Gold RT-PCR kit (PE Biosystems, Foster City, California) using the universal amplification conditions specified for the kit. Anti-HCV antibodies were measured using the third generation HCV Version 3.0 ELISA (OrthoDiagnostics, Raritan, New Jersey ). All procedures were approved by the institutional animal care and use committee.

Figure 4 T cell proliferative response to hepatitis C virus (HCV) reinfection. A chimpanzee that had previously cleared infection with the H77 genotype 1a strain of HCV was rechallenged with the same inoculum. The peripheral blood mononuclear cell proliferation response to HCV antigens was examined at various time points after infection. The proliferative response to the NS3-NS4 domain (c200) is shown.
Table 1 Profile of fold changes in liver gene expression during acute hepatitis C virus (HCV) infectiona
aFold changes in gene expression are in comparison to a day 0 sample taken before HCV infection. The number of genes, within a given range of fold change, are given in the columns below each time point.
Copyright © 2008. National Academy of Sciences.
All rights reserved.
500 Fifth St. N.W., Washington, D.C. 20001.
Terms of Use and Privacy Statement